Journal: bioRxiv

Article Title: A Yeast Two-Hybrid Protein Domain Screening Approach for Ebola Virus-Human Protein Interactions Identifies PABPC1 as a Host Factor Required for Replication

doi: 10.64898/2026.03.05.709814

Figure Lengend Snippet: Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by mRNA signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.

Article Snippet: Unidirectional cDNA was prepared from 1 μg of total RNA using the NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina following the “Protocol for use with NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490)” through step 1.7 (Manual Version 5.0 5/15) with the following changes: 1) poly(A)+ mRNA was eluted for 5 minutes at 65 °C to prevent fragmentation; 2) after synthesizing second strand cDNA, the cDNA was purified using a Zymo Research DNA Clean & Concentrator-5 column (#D4013); 3) the adaptor primer (/5Phos/GATCGGAAGAGCTTGTTCTACCGAGGGACCC/ideoxyU/ ACTACTGCCTAAC GAACTCCCGCTCTTCCGATC*T; * indicates a phosphorothioate bond; synthesized and PAGE purified by IDT) was a modification of the NEBNext Adaptor for Illumina (E7352A).

Techniques: Inhibition, Expressing, Transfection, Negative Control, Infection, Staining, Isolation, Quantitative RT-PCR, SDS Page, Western Blot, Molecular Weight

Journal: PLoS ONE

Article Title: Temporal Association of Herpes Simplex Virus ICP4 with Cellular Complexes Functioning at Multiple Steps in PolII Transcription

doi: 10.1371/journal.pone.0078242

Figure Lengend Snippet: Novel complexes copurifying with ICP4 (spectral counts).

Article Snippet: The antibodies used to probe the membranes were; N15, polyclonal rabbit serum, for ICP4 (1:500), Trap220/Med 1 (sc-8998-X), Med6 (sc-9434), Med 4 (NBP1-84977; Novus Biologicals), Med23 (550429; BD Bio), CDK8 (sc-1521), Med12 (NB100-2357; Novus Biologicals), Med 13 ((NB100-60642; Novus Biologicals), Med 26 (sc-166614), TAF1 (sc735), TBP (233-R Covance), p62 (sc292-X), p80/XPB (sc-20696-x), CPSF2 (sc-165983), CPSF7 (NB100-61600; Novus Biologicals), Brahma (sc-6450), CHD3 (ABE86; Milipore), RUVBL1 (06-1299; Milipore), RUVBL2 (06-1300; Milipore) at the manufacturers recommended dilutions.

Techniques:

Journal: PLoS ONE

Article Title: Temporal Association of Herpes Simplex Virus ICP4 with Cellular Complexes Functioning at Multiple Steps in PolII Transcription

doi: 10.1371/journal.pone.0078242

Figure Lengend Snippet: Western blot analysis of nuclear extracts (NE) or affinity purified (PD) samples collected at 6 hpi using either wtICP4 (KOS) or TAP-wtICP4 (TAP) expressing viruses. Antibodies directed against (A) p80 and p62 of TFIIH, (B) CPSF2 and CPSF7 of the cleavage and polyadenylation complex and (C) Brahma of Swi/Snf, CHD3 of the Nurd complex, and RuvBL1 and RuvBL2 of the Ino80 complex were used.

Article Snippet: The antibodies used to probe the membranes were; N15, polyclonal rabbit serum, for ICP4 (1:500), Trap220/Med 1 (sc-8998-X), Med6 (sc-9434), Med 4 (NBP1-84977; Novus Biologicals), Med23 (550429; BD Bio), CDK8 (sc-1521), Med12 (NB100-2357; Novus Biologicals), Med 13 ((NB100-60642; Novus Biologicals), Med 26 (sc-166614), TAF1 (sc735), TBP (233-R Covance), p62 (sc292-X), p80/XPB (sc-20696-x), CPSF2 (sc-165983), CPSF7 (NB100-61600; Novus Biologicals), Brahma (sc-6450), CHD3 (ABE86; Milipore), RUVBL1 (06-1299; Milipore), RUVBL2 (06-1300; Milipore) at the manufacturers recommended dilutions.

Techniques: Western Blot, Affinity Purification, Expressing

Journal: Research

Article Title: CHAtRF Modulates Cardiac Hypertrophy via SRSF5-Dependent Regulation of Psmg4 Alternative Splicing

doi: 10.34133/research.1202

Figure Lengend Snippet: CHAtRF binds to splicing factor SRSF5 to regulate mRNA alternative splicing. (A) LC-MS/MS identification of SRSF5. (B) RNA immunoprecipitation using SRSF5 antibody followed by qPCR analysis showing CHAtRF enriched in SRSF5 fraction ( n = 6 independent experiments). (C) RNA pull-down assay was carried out using biotinylated CHAtRF (Bio-CHAtRF) or NC (Bio-NC) and WB analysis showing that CHAtRF binds with SRSF5 protein. (D) Data of RNA immunoprecipitation sequencing with anti-SRSF5 antibody in NC and CHAtRF knockdown cells. (E) Summary of differential splicing analysis performed using anta- or NC-transfected cardiomyocytes. (F) Numbers of predicted alternative splicing (AS) events in each category upon CHAtRF deletion. (G) Venn diagrams showing overlap of RIP-seq genes, RNA-seq genes, and AS genes in CHAtRF anta- or NC-transfected cardiomyocytes. (H) Alternative sites in Psmg4 gene bound directly by SRSF5 from RIP-seq and RNA-seq using IGV software. (I) RT-PCR analysis for AS event of Psmg4 gene in NC- and CHAtRF-overexpressed cardiomyocytes. The middle panels represent the schematic diagram of indicated AS exons. Right panels show the quantification of percent spliced-in (PSI) ( n = 7 independent experiments). Data are presented as mean ± SD. Data presented in (B) and (I) were analyzed by Student,s t test (2-tailed).

Article Snippet: The NC- or anta-transfected cells were lysed and then immunoprecipitated with anti-SRSF5 antibody (Proteintech, 16237-1-AP) or anti-immunoglobulin G (IgG) (Abclonal, China) using rProtein A/G agarose resin (Yeasen, 36403ES08).

Techniques: Alternative Splicing, Liquid Chromatography with Mass Spectroscopy, RNA Immunoprecipitation, Pull Down Assay, Sequencing, Knockdown, Transfection, RNA Sequencing, Software, Reverse Transcription Polymerase Chain Reaction

Journal: Research

Article Title: CHAtRF Modulates Cardiac Hypertrophy via SRSF5-Dependent Regulation of Psmg4 Alternative Splicing

doi: 10.34133/research.1202

Figure Lengend Snippet: CHAtRF blocks SRSF5 to mediate the AS of Psmg4. (A) RIP-qPCR analysis showing relative binding level of SRSF5 to Psmg4 mRNA in NC or CHAtRF-overexpressed cardiomyocytes ( n = 6 independent experiments). (B) WB analyses of the expression of Psmg4 protein in NC or CHAtRF-overexpressed cardiomyocytes. GAPDH was used as a loading control. (C) RIP-qPCR analysis showing relative binding level of SRSF5 to Psmg4 mRNA in NC- or anta-transfected cardiomyocytes ( n = 6 independent experiments). (D) RT-PCR analysis for AS events of Psmg4 gene in cardiomyocytes transfected with anta, si-NC, or si-Srsf5. (E) Quantification of PSI ( n = 8 independent experiments). (F) Cardiomyocytes were transfected with anta or NC for 24 h, and then cells were treated with AngII. RT-PCR analysis for AS events of Psmg4 gene. (G) Quantification of PSI ( n = 7 independent experiments). (H) WB analyses of the expression of Psmg4 protein in cardiomyocytes transfected with anta or NC for 24 h and then treated with AngII. GAPDH was used as a loading control ( n = 6 independent experiments). (I) Schematics for the full-length Psmg4 domains and the Psmg4 minigene-splicing reporter based on the Psmg4 genomic locus. Lengths of exons and introns are indicated. (J) 293T cells were transfected with Psmg4 mini plasmid and adenovirus harboring Srsf5. RT-PCR analysis of the splicing pattern of the Psmg4 mini reporter (left panel) and quantification of RT-PCR data (right panel) were shown ( n = 8 independent experiments). Data are presented as mean ± SD. Data presented in (A) and (B) were analyzed by Student,s t test (2-tailed). Data presented in (C) were analyzed by 2-way ANOVA with Tukey post hoc test. Data presented in (E), (G), (H), and (J) were analyzed by one-way ANOVA with Tukey post hoc test.

Article Snippet: The NC- or anta-transfected cells were lysed and then immunoprecipitated with anti-SRSF5 antibody (Proteintech, 16237-1-AP) or anti-immunoglobulin G (IgG) (Abclonal, China) using rProtein A/G agarose resin (Yeasen, 36403ES08).

Techniques: Binding Assay, Expressing, Control, Transfection, Reverse Transcription Polymerase Chain Reaction, Plasmid Preparation

Journal: Research

Article Title: CHAtRF Modulates Cardiac Hypertrophy via SRSF5-Dependent Regulation of Psmg4 Alternative Splicing

doi: 10.34133/research.1202

Figure Lengend Snippet: Psmg4 and SRSF5 function as downstream molecules of CHAtRF in cardiac hypertrophy. (A to C) Mice were treated with AngII and transfected with CHAtRF anta or its NC, while infected with adenovirus harboring shPsmg4 or shCTRL. (A) Top row: Representative images of gross morphology of hearts. Scale bar, 2 mm. Bottom row: Representative images of left ventricular muscle sections stained with WGA. Scale bar, 25 μm. (B) HW/BW ratio ( n = 6 to 8 mice per group). (C) Analysis of the cardiomyocyte sizes in histological sections stained with WGA ( n = 7 to 8 mice per group). (D and E) Cardiomyocytes were treated with AngII and transfected with CHAtRF anta or its NC, while infected with adenovirus harboring shPsmg4 or shCTRL. (D) Cardiomyocytes were stained by phalloidin, and quantitative analysis of the cell surface area was assessed ( n = 6 independent experiments). (E) qPCR results showing BNP mRNA level ( n = 6 independent experiments). (F) Schematic diagram of tamoxifen (TAM)-induced generation in SRSF5-cKO mice. NC mice were SRSF5 flox/flox mice, and SRSF5-cKO mice were crosses between α-MHCMerCreMer mice and SRSF5 fl/fl mice. (G) WB showed SRSF5 expression in SRSF5 fl/fl mice and SRSF5-cKO mice ( n = 8 mice per group). (H) Representative images of gross morphology of SRSF5-cKO mice and SRSF5 fl/fl mouse hearts. Scale bar, 2 mm. (I) Analysis of HW/BW ratio in the SRSF5-cKO and SRSF5 fl/fl mice ( n = 9 mice per group). (J to M) SRSF5-cKO and SRSF5 fl/fl mice were injected with AngII and transfected with CHAtRF anta or its NC. (J) HW/BW ratio ( n = 6 to 8 mice per group). (K) qPCR results showing BNP mRNA level ( n = 6 mice per group). (L) RT-PCR analysis of the splicing pattern of the Psmg4 gene (left panel) and quantification of RT-PCR data (right panel) ( n = 6 independent experiments). Data are presented as mean ± SD. Data presented in (B) to (E) were analyzed by one-way ANOVA with Tukey post hoc test. Data presented in (G) to (I) were analyzed by Student,s t test (2-tailed). Data presented in (J), (K), and (M) were analyzed by 2-way ANOVA with Tukey post hoc test.

Article Snippet: The NC- or anta-transfected cells were lysed and then immunoprecipitated with anti-SRSF5 antibody (Proteintech, 16237-1-AP) or anti-immunoglobulin G (IgG) (Abclonal, China) using rProtein A/G agarose resin (Yeasen, 36403ES08).

Techniques: Transfection, Infection, Staining, Expressing, Injection, Reverse Transcription Polymerase Chain Reaction

Journal: Research

Article Title: CHAtRF Modulates Cardiac Hypertrophy via SRSF5-Dependent Regulation of Psmg4 Alternative Splicing

doi: 10.34133/research.1202

Figure Lengend Snippet: The effects of CHAtRF knockdown in established cardiac hypertrophy. (A) Schematic diagram of the CHAtRF anta injection and the experimental procedure. (B) qPCR results showing CHAtRF levels ( n = 6 mice per group). (C) Top row: Analysis of cardiac morphology. Scale bar, 2 mm. Bottom row: Representative images of coronal sections of heart stained with hematoxylin and eosin. Scale bar, 2 mm. (D) HW/BW ratio ( n = 8 to 9 mice per group). (E) Analysis of cardiomyocytes size ( n = 6 to 8 mice per group). (F) qPCR results showing BNP mRNA levels ( n = 6 mice per group). (G) Representative images of Masson,s trichrome-stained and semiquantitative analysis of histological sections of left ventricle. Scale bar, 20 μm ( n = 6 to 8 mice per group). (H) Cardiac function measured by left ventricle ejection fraction (EF) using echocardiography ( n = 6 to 8 mice per group). (I) Schematic diagram of CHAtRF function in hypertrophic signaling. CHAtRF participates in the regulation of cardiac hypertrophy by targeting the SRSF5/Psmg4 pathway. In our model, overexpression of CHAtRF prevents the binding of SRSF5 to Psmg4 pre-mRNA, resulting in AS of Psmg4 (exon 2 skipping) and a shift in Psmg4 full-length or short isoform expression, which subsequently promotes cardiac hypertrophy. Data are presented as mean ± SD. Data presented in (B) and (D) to (H) were analyzed by one-way ANOVA with Tukey post hoc test.

Article Snippet: The NC- or anta-transfected cells were lysed and then immunoprecipitated with anti-SRSF5 antibody (Proteintech, 16237-1-AP) or anti-immunoglobulin G (IgG) (Abclonal, China) using rProtein A/G agarose resin (Yeasen, 36403ES08).

Techniques: Knockdown, Injection, Staining, Over Expression, Binding Assay, Expressing

Journal: Molecular Therapy. Methods & Clinical Development

Article Title: Modulation of the pharmacokinetics of soluble ACE2 decoy receptors through glycosylation

doi: 10.1016/j.omtm.2024.101301

Figure Lengend Snippet: A single dose of sACE2 2 .S19-IgG1(YTE) sourced from Expi293F culture protects K18-hACE2 mice from lethal SARS-CoV-2 challenge (A and B) K18-hACE2 mice were inoculated intranasally with 1 × 10 4 PFU 2019n-CoV/USA_WA1/2020 virus. Mice were administered a single i.v. dose (10 mg/kg) of sACE2 2 .S19-IgG1(YTE) (red; purified from transiently transfected Expi293F culture) or IgG1 control (gray) 24 h post-inoculation. Survival (A) and weights (B) for N = 10 mice per treatment group. p value determined by Gehan-Breslow-Wilcoxon test. (C and D) Lungs of inoculated mice were harvested at day 7 and relative viral loads were determined by qPCR for mRNA expression levels of SARS-CoV-2 Spike (C) and Nsp (D). Mean ± SEM, N = 4 per treatment group. p values determined by unpaired t test.

Article Snippet: Cells were transfected via electroporation using the Bio-Rad Gene Pulse XCell; 1 × 10 7 cells in 700 μL CD-CHO medium were combined with 100 μL (40 μg) linearized DNA and 5 μg piggyBac Transposase mRNA (Lonza Biologics) in a 0.4-cm gap electroporation cuvette and pulsed at 300 V, 900 μF.

Techniques: Virus, Purification, Transfection, Control, Expressing

Journal: Scientific Reports

Article Title: RNA modifications, alternative splicing and circular RNA landscape in the mouse brain: inosine and beyond

doi: 10.1038/s41598-025-30030-4

Figure Lengend Snippet: Enrichment of RNA Modifications in nuclear polyA RNA and Splicing-Inhibited mRNAs. (a) Schematic representation illustrating RNA modifications enriched in pre-mRNA containing introns, with isolation strategy for nuclear polyA RNA (polyA selected from nuclear enriched RNA) and total polyA RNA (polyA selected, total RNA) from WT mouse brain samples to quantify RNA modifications with Liquid Chromatography-Tandem Mass Spectrometry (LC–MS/MS). (b) Comparison of RNA modification abundance between nuclear and total mRNA samples, revealing a reduction and increase in various RNA modifications. 5-methylcytosine (m5C); 2'-O-methylcytidine (Cm); 7-methylguanosine (m7G); 1-methylguanosine (m1G); N2,N2-dimethylguanosine (Gm); Pseudouridine (Ψ); 2'-O-methyluridine (Um); inosine (I); 1-methyladenosine (Am); N6-methyladenosine (m6A); N6,N6-dimethyladenosine (m6Am); n = 3; mean ± SD; t-test; * P < 0.05; ** P < 0.01; *** P < 0.001. (c) Experimental setup for analyzing RNA modifications in splicing-inhibited mRNAs in primary neurons using Pladienolide B (PlaB) and 4-thiouridine (4SU) to selectively label and isolate unspliced transcripts. (d) Analysis of RNA modification abundance in unspliced versus spliced mRNA transcripts. N2, N2,7-trimethylguanosine (m22G); n = 3; mean ± SD; t-test; * P < 0.05; ** P < 0.01; *** P < 0.001.

Article Snippet: TurboCapture mRNA Kit (QIAGEN, 72,251) was used to isolate polyA RNA according to the manual’s instructions.

Techniques: Isolation, Liquid Chromatography, Mass Spectrometry, Liquid Chromatography with Mass Spectroscopy, Comparison, RNA modification

Journal: Scientific Reports

Article Title: RNA modifications, alternative splicing and circular RNA landscape in the mouse brain: inosine and beyond

doi: 10.1038/s41598-025-30030-4

Figure Lengend Snippet: Impact of ADAR Enzyme Pertrubations on the Global RNA and DNA Modification Landscape in the Mouse Brain. (a) Experimental design illustrating the manipulation of inosine levels in pre-mRNAs to investigate the influence of inosine on the mRNA and circRNA landscape in the brain using ADAR2 deficient ( Adar2 KO ) mice and mice lacking the enzymatic activity of ADAR1 and deficient for ADAR2 ( Adar1/2 KO ). (b) Quantification of inosine (I) in total RNA from Adar2 KO and Adar1/2 KO mice through Liquid Chromatography-Tandem Mass Spectrometry (LC–MS/MS). n = 3; mean ± SD; t-test; ** P < 0.01. (c) Assessment of global RNA modification changes in Adar2 KO and Adar1/2 KO mice through LC–MS/MS, showing alterations in m1G, Gm, m5U, m6A, and m6Am levels compared to WT controls. 5-methylcytosine (m5C); 2'-O-methylcytidine (Cm); 7-methylguanosine (m7G); 1-methylguanosine (m1G); N2,N2-dimethylguanosine (Gm); N2,N2,7-trimethylguanosine (m22G); Pseudouridine (Ψ); 2'-O-methyluridine (Um); 5-methyluridine (m5U); 1-methyladenosine (m1A); N6-methyladenosine (m6A); N6,N6-dimethyladenosine (m6Am); n = 3; mean ± SD; t-test; * P < 0.05; ** P < 0.01. (d) Analysis of long RNAs (> 200nt) from Adar2 KO and Adar1/2 KO mice through LC–MS/MS, demonstrating significant enrichment of m1G, m22G, m5U, and m6Am, with alterations in m5C, m7G, and m1A levels in Adar2 KO mice. n = 3; mean ± SD; t-test; * P < 0.05; ** P < 0.01; *** P < 0.001. (e) Examination of small RNAs (< 200nt) from Adar2 KO and Adar1/2 KO mice through LC–MS/MS, indicating depletion of Am, m6A, and m6Am, along with changes in m5C, m7G, I and m22G levels compared to WT controls. n = 3; mean ± SD; t-test; * P < 0.05; ** P < 0.01; *** P < 0.001. (f) DNA modifications in WT and mutant mouse brains for ADAR enzymes by LC–MS/MS, revealing a reduction in m5dC levels and an increase in hm5dC levels in Adar1/2 KO mice, deoxyinosine (dI). n = 3; mean ± SD; t-test; * P < 0.05; ** P < 0.01.

Article Snippet: TurboCapture mRNA Kit (QIAGEN, 72,251) was used to isolate polyA RNA according to the manual’s instructions.

Techniques: Modification, Activity Assay, Liquid Chromatography, Mass Spectrometry, Liquid Chromatography with Mass Spectroscopy, RNA modification, Mutagenesis

Journal: Scientific Reports

Article Title: RNA modifications, alternative splicing and circular RNA landscape in the mouse brain: inosine and beyond

doi: 10.1038/s41598-025-30030-4

Figure Lengend Snippet: Influence of Inosine-Regulated Transcripts by ADAR Enzymes on Circular RNA Profiles. (a) Investigation of circular RNAs (circRNAs) in mouse brains following loss of ADAR2 and the combination of ADAR2 loss and ADAR1 catalytic activity using ONT and Illumina sequencing to identify and predict circRNAs landscape. (b) Volcano plot illustrating the fold-change (log 2 ) and significance of circRNA expression changes between Adar2 KO and Adar1/2 KO versus WT mouse brains. This plot highlights circRNAs originating from edited pre-mRNA transcripts in red and circRNAs originating from non-edited pre-mRNAs in black. (c) Analysis of circRNA lengths and distributions in Adar2 KO and Adar1/2 KO mouse brains, demonstrating predominant sizes between 500 to 1,000 nucleotides. Each line represents data per biological replicate. n = 3. (d) Composition analysis of circRNAs in WT, Adar2 KO , and Adar1/2 KO mouse brains. circRNAs are predominantly composed of exonic sequences, across all samples. (e) Validation of differential AS patterns in Adar2-circ , a circRNA originating from Adar2 pre-mRNA, in WT, Adar2 KO and Adar1/2 KO mouse brains. RT-qPCR results confirm distinct AS patterns in Adar2 KO and Adar1/2 KO mouse brain datasets. Expression levels were normalized to the housekeeping gene ß-actin and to WT levels n = 3; mean ± SD; t-test; ** P < 0.01; *** P < 0.001. (f) Illustration of Adar2-circ formation from the Adar2 gene where exon 6 has been deleted in Adar2 KO and Adar1/2 KO mice. Ex = exon; KO = knockout. (g) Detection and validation of differentially regulated circRNAs, Fstl5-circ-1 and Fstl5-circ-2 from the Fstl5 gene , Mettl6-circ from the Mettl6 gene, Gabra2-circ-1 and Gabra2-circ-2 from the Gabra2 gene, in Adar2 KO and Adar1/2 KO mouse brains. Expression levels were normalized to the housekeeping gene ß-actin and to WT levels. n = 3; mean ± SD; t-test; ** P < 0.01; *** P < 0.001.

Article Snippet: TurboCapture mRNA Kit (QIAGEN, 72,251) was used to isolate polyA RNA according to the manual’s instructions.

Techniques: Activity Assay, Illumina Sequencing, Expressing, Biomarker Discovery, Quantitative RT-PCR, Knock-Out